Command Line Quickstart
Learn to use the dx client for command-line access to the full range of DNAnexus Platform features.
You must set up billing for your account before you can perform an analysis, or upload or egress data. Follow these instructions to set up billing.
The
dx command-line client is included in the DNAnexus SDK (dx-toolkit). You can use the dx client to log into the Platform; to upload, browse, and organize data; and to launch analyses.All the projects and data referenced in this Quickstart are publicly available, so you can follow along step-by-step.
At the command line, you can also enter
dx helpto see a list of commands, broken down by category. To see a list of commands from a particular category, enter dx help <category>. To learn what a particular command does, enter
dx help <command>, dx <command> -h, or dx <command> -help For example, enter dx help lsto learn about the command dx ls:$ dx help ls
usage: dx ls [-h] [--color {off,on,auto}] [--delimiter [DELIMITER]]
[--env-help] [--brief | --summary | --verbose] [-a] [-l] [--obj]
[--folders] [--full]
[path]
List folders and/or objects in a folder
... # output truncated for brevity
To use the command-line interface (CLI), make sure you've installed the DNAnexus Software Development Kit (SDK) available here.
$ dx login
Acquiring credentials from https://auth.dnanexus.com
Username: <your username>
Password: <your password>
No projects to choose from. You can create one with the command "dx new project". To pick from projects for which you only have VIEW permissions, use "dx select --level VIEW" or "dx select --public".
Your authentication token and your current project settings have now been saved in a local configuration file, and you're ready to start accessing your project.
Let's look inside some of the public projects that have already been set up. From the command line, enter the command:
$ dx select --public --name "Reference Genome Files*"
By running the
dx select command and picking a project, you've now done the command-line equivalent of going to the project page for Reference Genome Files: AWS US (East) (platform login required to access this link) on the website. This is a DNAnexus-sponsored project containing popular genomes for you to use when running analyses with your own data.For more information about the
dx select command, please see the Changing Your Current Project page.You will never be charged for DNAnexus-sponsored data, so you can copy data from this project however many times you'd like, free of charge.
Now you can list all of the data in the top-level directory of the project you've just selected by running the command
dx ls. You can also see the contents of a folder by running the command dx ls <folder_name>.$ dx ls
C. Elegans - Ce10/
D. melanogaster - Dm3/
H. Sapiens - GRCh37 - b37 (1000 Genomes Phase I)/
H. Sapiens - GRCh37 - hs37d5 (1000 Genomes Phase II)/
H. Sapiens - GRCh38/
H. Sapiens - hg19 (Ion Torrent)/
H. Sapiens - hg19 (UCSC)/
M. musculus - mm10/
M. musculus - mm9/
$ dx ls "C. Elegans - Ce10/"
ce10.bt2-index.tar.gz
ce10.bwa-index.tar.gz
... # output truncated for brevity
You can avoid typing out the full name of the folder by typing in
dx ls C and then pressing <TAB>. The folder name will auto-complete from there.You don't have to be in a project to inspect its contents. You can also look into another project, and a folder within the project, by giving the project name or ID, followed by a colon (
:) and the folder path. Here, we list the contents of the publicly available project "Demo Data" using both its name and ID.$ dx ls "Demo Data:/SRR100022/"
SRR100022_1.filt.fastq.gz
SRR100022_2.filt.fastq.gz
$ dx ls -l "project-BQbJpBj0bvygyQxgQ1800Jkk:/SRR100022/"
Project: Demo Data (project-BQbJpBj0bvygyQxgQ1800Jkk)
Folder : /SRR100022
State Last modified Size Name (ID)
... # output truncated for brevity
As shown above, you can use the
-l flag in conjunction with dx ls to list more details about files, such as the time a file was last modified, its size (if applicable), and its full DNAnexus ID.You can use the
dx describe command to learn more about files and other objects on the platform. Given a DNAnexus object ID or name, dx describe will return detailed information about the object in question. dx describe will only return results for data objects to which you have access.Besides describing data and projects (examples for which are shown below), you can also describe apps, jobs, and users.
Example: Describing a File
Below, we describe the reference genome file for C. elegans located in the "Reference Genome Files: AWS US (East)" project that we've been using (which should be accessible from other regions as well). Note that you need to add a colon (:) after the project name, here that would be
Reference Genome Files\: AWS US (East): .$ dx describe "Reference Genome Files\: AWS US (East):/C. Elegans - Ce10/ce10.fasta.gz"
Result 1:
ID file-BQbY9Bj015pB7JJVX0vQ7vj5
Class file
Project project-BQpp3Y804Y0xbyG4GJPQ01xv
Folder /C. Elegans - Ce10
Name ce10.fasta.gz
State closed
Visibility visible
Types -
Properties Assembly=UCSC ce10,
Origin=http://hgdownload.cse.ucsc.edu/goldenPath/ce10/bigZip
s/ce10.2bit, Species=Caenorhabditis elegans, Taxonomy
ID=6239
Tags -
Outgoing links -
Created Tue Sep 30 18:54:35 2014
Created by bhannigan
via the job job-BQbY8y80KKgP380QVQY000qz
Last modified Thu Mar 2 12:17:27 2017
Media type application/x-gzip
archivalState "live"
Size 29.21 MB, sponsored by DNAnexus
Example: Describing a Project
Below, we describe the publicly available Reference Genome Files project that we've been using.
$ dx describe "Reference Genome Files\: AWS US (East):"
Result 1:
ID project-BQpp3Y804Y0xbyG4GJPQ01xv
Class project
Name Reference Genome Files: AWS US (East)
Summary
Billed to org-dnanexus
Access level VIEW
Region aws:us-east-1
Protected true
Restricted false
Contains PHI false
Created Wed Oct 8 16:42:53 2014
Created by tnguyen
Last modified Tue Oct 23 14:15:59 2018
Data usage 0.00 GB
Sponsored data 519.77 GB
Sponsored egress 0.00 GB used of 0.00 GB total
Tags -
Properties -
downloadRestricted false
defaultInstanceType "mem2_hdd2_x2"
$ dx new project "My First Project"
Created new project called "My First Project"
(project-xxxx)
Switch to new project now? [y/N]: y
The text project-xxxx denotes a placeholder for a unique, immutable project ID. For more information about object IDs, see the Entity IDs page.
You're now ready to start uploading your data and running your own analyses.
The
new command can also allow you to create other new data objects, including new orgs or users. Use the command dx help new to see additional information. The full list of dx commands is provided here.If you have a sample you would like to analyze, you can use the
dx upload command or the Upload Agent if you have installed it. For the purposes of this tutorial, you can also download the file small-celegans-sample.fastq, which represents the first 25000 C. elegans reads from SRR070372. We will use this file again later to run through a sample analysis.For uploading multiple or large files, we strongly recommend that you use the Upload Agent; it will compress your files and upload them in parallel over multiple HTTP connections and boasts other features such as resumable uploads.
The following command uploads the
small-celegans-sample.fastq file into the current directory of the current project. The --wait flag tells dx upload to wait until it has finished uploading the data before returning the prompt and describing the result.$ dx upload --wait small-celegans-sample.fastq
[===========================================================>] Uploaded (16801690 of 16801690 bytes) 100% small-celegans-sample.fastq
ID file-xxxx
Class file
Project project-xxxx
Folder /
Name small-celegans-sample.fastq
State closed
Visibility visible
Types -
Properties -
Tags -
Details {}
Outgoing links -
Created Sun Jan 1 09:00:00 2017
Created by amy
Last modified Sat Jan 1 09:00:00 2017
Media type text/plain
Size 16.02 MB
If you run the same command but add the flag
--brief, only the file ID (in the form of file-xxxx) will be printed to the terminal. Other dx commands will also accept the --brief flag and will also report only object IDs.To take a quick look at the first few lines of the file you just uploaded, use the
dx head command. By default, it prints the first 10 lines of the given file.Let's run it on the file we just uploaded and use the
-n flag to ask for the first 12 lines (the first 3 reads) of the FASTQ file.$ dx head -n 12 small-celegans-sample.fastq
@SRR070372.1 FV5358E02GLGSF length=78
TTTTTTTTTTTTTTTTTTTTTTTTTTTNTTTNTTTNTTTNTTTATTTATTTATTTATTATTATATATATATATATATA
+SRR070372.1 FV5358E02GLGSF length=78
...000//////999999<<<=<<666!602!777!922!688:669A9=<=122569AAA?>@BBBBAA?=<96632
@SRR070372.2 FV5358E02FQJUJ length=177
TTTCTTGTAATTTGTTGGAATACGAGAACATCGTCAATAATATATCGTATGAATTGAACCACACGGCACATATTTGAACTTGTTCGTGAAATTTAGCGAACCTGGCAGGACTCGAACCTCCAATCTTCGGATCCGAAGTCCGACGCCCCCGCGTCGGATGCGTTGTTACCACTGCTT
+SRR070372.2 FV5358E02FQJUJ length=177
[email protected]>C<[email protected]<GIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIC;6666IIIIIIIIIIII;;;HHIIE>944=>=;22499;CIIIIIIIIIIIIHHHIIIIIIIIIIIIIIIH?;;;?IIEEEEEEEEIIII77777I7EEIIEEHHHHHIIIIIIIIIIIIII
@SRR070372.3 FV5358E02GYL4S length=70
TTGGTATCATTGATATTCATTCTGGAGAACGATGGAACATACAAGAATTGTGTTAAGACCTGCATAAGGG
+SRR070372.3 FV5358E02GYL4S length=70
@@@@@[email protected]=?::[email protected]?DFFHHFDDDDFFFDDBBBB<<410
If you'd like to download a file from the platform, just use the
dx download command. This command will use the name of the file for the filename unless you specify your own with the -o/--output flag. In the example below, we download the same C. elegans file that we uploaded previously.$ dx download small-celegans-sample.fastq
[ ] Downloaded 0 byte
[===========================================================>] Downloaded 16.02 of
[===========================================================>] Completed 16.02 of 16.02 bytes (100%) small-celegans-sample.fastq
Files have different available fields for metadata, such as "properties" (key-value pairs) and "tags".
For the next few steps, if you would like to follow along, you will need a C. elegans FASTQ file. We will map the reads against the ce10 genome. If you haven't already, you can download and use the following FASTQ file, which contains the first 25,000 reads from SRR070372: small-celegans-sample.fastq.
You can also substitute your own reads file for a different species (though it may take longer to run through the example). For your convenience, DNAnexus has already imported a variety of reference genomes to the platform. If you have your own FASTA file that you would like to use, you can upload the file and create genome indices for either BWA or Bowtie2 using the BWA FASTA Indexer app or the Bowtie2 FASTA Indexer app (platform login required to access these links).
The following walkthrough is helpful if you would like to understand what all the commands do and take a look at what apps you're running, but if you're just interested in converting a gzipped FASTQ file to a VCF file via BWA and the FreeBayes variant caller, then you can skip ahead to the Automate It section below, where you can see all the commands necessary for running apps.
If you have not yet done so, you can upload a FASTQ file for analysis.
$ dx upload small-celegans-sample.fastq --wait
Next, use the BWA-MEM app (platform login required to access this link) to map the uploaded reads file to a reference genome.
First of all, if you don't know the command-line name of the app you would like to run, you have two options:
- 1.You can navigate to its web page from the Apps page (platform login required to access this link) on the platform. The app's page will tell you how to run it from the command line. You can find more information about the app we're running on the BWA-MEM FASTQ Read Mapper page (platform login required to access this link).
- 2.Alternatively, you can search for apps from the command line by running the command
dx find apps. You will find the name of the app that you can use on the command line in the parentheses (underlined below).
$ dx find apps
...
x BWA-MEM FASTQ Read Mapper (bwa_mem_fastq_read_mapper), v1.4.0
...
Now install the app using
dx install and check that it has been installed. While you do not always need to install an app to run it, you may find it useful as a bookmarking tool.$ dx install bwa_mem_fastq_read_mapper
Installed the bwa_mem_fastq_read_mapper app
$ dx find apps --installed
BWA-MEM FASTQ Read Mapper (bwa_mem_fastq_read_mapper), v1.4.0
We can now run the app using
dx run. We will run it without any arguments; it will then prompt us for required and then optional arguments. Note that the reference file genomeindex_targz for the C. elegans sample we are using is in a .tar.gz format and can be found in the Reference Genome folder of the region your project is in.$ dx run bwa_mem_fastq_read_mapper
Entering interactive mode for input selection.
Input: Reads (reads_fastqgz)
Class: file
Enter file ID or path (<TAB> twice for compatible files in current directory,'?' for help)
reads_fastqgz[0]: <small-celegans-sample.fastq.gz>
Input: BWA reference genome index (genomeindex_targz)
Class: file
Suggestions:
project-BQpp3Y804Y0xbyG4GJPQ01xv://file-\* (DNAnexus Reference Genomes)
Enter file ID or path (<TAB> twice for compatible files in current
directory,'?' for more options)
genomeindex_targz: <"Reference Genome Files\: <REGION_OF_PROJECT>:/C. Elegans - Ce10/ce10.bwa-index.tar.gz">
Select an optional parameter to set by its # (^D or <ENTER> to finish):
[0] Reads (right mates) (reads2_fastqgz)
[1] Add read group information to the mappings (required by downstream GATK)? (add_read_group) [default=true]
[2] Read group id (read_group_id) [default={"$dnanexus_link": {"input": "reads_fastqgz", "metadata": "name"}}]
[3] Read group platform (read_group_platform) [default="ILLUMINA"]
[4] Read group platform unit (read_group_platform_unit) [default="None"]
[5] Read group library (read_group_library) [default="1"]
[6] Read group sample (read_group_sample) [default="1"]
[7] Output all alignments for single/unpaired reads? (all_alignments)
[8] Mark shorter split hits as secondary? (mark_as_secondary) [default=true]
[9] Advanced command line options (advanced_options)
Optional param #: <ENTER>
Using input JSON:
{
"reads_fastqgz": {
"$dnanexus_link": {
"project": "project-B3X8bjBqqBk1y7bVPkvQ0001",
"id": "file-B3P6v02KZbFFkQ2xj0JQ005Y"
}
"genomeindex_targz": {
"$dnanexus_link": {
"project": "project-xxxx(project ID for the reference genome in your region)",
"id": "file-BQbYJpQ09j3x9Fj30kf003JG"
}
}
}
Confirm running the applet/app with this input [Y/n]: <ENTER>
Calling app-BP2xVx80fVy0z92VYVXQ009j with output destination
project-xxxx:/
Job ID: job-xxxx
You can use the command
dx watch to monitor jobs. The command will print out the log file of the job, including the STDOUT, STDERR, and INFO printouts.You can also use the command
dx describe job-xxxx to learn more about your job. If you don't know the job's ID, you can use the command dx find jobs to list all the jobs run in the current project, along with the user who ran them, their status, and when they began.$ dx find jobs
* BWA-MEM FASTQ Read Mapper (bwa_mem_fastq_read_mapper:main)(done) job-xxxx
user-amy 20xx-xx-xx 0x:00:00 (runtime 0:00:xx)
$ dx describe job-xxxx
...
There are also additional options that you can use to restrict your search of previous jobs, such as by their names or when they were run.
If for some reason you need to terminate your job before it completes, use the command
dx terminate.You should now see two new files in your project: the mapped reads in a BAM file, and an index of that BAM file with a
.bai extension. You can refer to the output file by name or by the job that produced it using the syntax job-xxxx:<output field>. Try it yourself with the job ID you got from calling the BWA-MEM app!$ dx ls
small-celegans-sample.bam
small-celegans-sample.bam.bai
small-celegans-sample.fastq
$ dx describe small-celegans-sample.bam
...
$ dx describe job-xxxx:sorted_bam
...
You can use the FreeBayes Variant Caller app (platform login required to access this link) to call variants on your BAM file.
This time, we won't rely on the interactive mode to enter our inputs. Instead, we will provide them directly. But first, let's look up the app's spec so we know what the inputs are called. For this, let's run the command
dx run freebayes -h.$ dx run freebayes -h
usage: dx run freebayes [-iINPUT_NAME=VALUE ...]
App: FreeBayes Variant Caller
Calls variants (SNPs, indels, and other events) using FreeBayes
See the app page for more information:
https://platform.dnanexus.com/app/freebayes
Inputs:
Sorted mappings: -isorted_bams=(file) [-isorted_bams=... [...]]
One or more coordinate-sorted BAM files containing mappings to call
variants for.
Genome: -igenome_fastagz=(file)
A file, in gzipped FASTA format, with the reference genome that the
reads were mapped against.
...
Optional inputs are shown using square brackets (
[]) around the command-line syntax for each input. You'll notice that there are two required inputs that must be specified:- 1.Sorted mappings (
sorted_bams): A list of files with a.bamextension. - 2.Genome (
genome_fastagz): A reference genome in FASTA format that has been gzipped.
You can also run
dx describe freebayes for a more compact view of the input and output specifications. By default, it will hide the advanced input options, but you can view them using the --verbose flag.Run the App with a One-Liner Using a Job-Based Object Reference
It is sometimes more convenient to run apps using a single one-line command. You can do this by specifying all the necessary inputs either via the command line or in a prepared file. We will use the
-i flag to specify inputs as suggested by the output of dx run freebayes ‑h:genome_fastagz: The ce10 genome in the Reference Genomes project.
To specify new job input using the output of a previous job, we'll use a [job-based object reference](/Developer-Tutorials/Sample-Code?bash#Use-job-based-object-references-(JBORs)) via the
job-xxxx:<output field> syntax we used earlier.You can use job-based object references as input even before the referenced jobs have finished. The system will simply wait until the input is ready to begin the new job.
Replace the job ID below with that generated by the BWA app you ran earlier. The
-y flag skips the input confirmation.$ dx run freebayes -y \
-igenome_fastagz=Reference\ Genome\ Files:/C.\ Elegans\ -\ Ce10/ce10.fasta.gz \
-isorted_bams=job-xxxx:sorted_bam
Using input JSON:
{
"genome_fastagz": {
"$dnanexus_link": {
"project": "project-xxxx",
"id": "file-xxxx"
}
},
"sorted_bams": {
"field": "sorted_bam",
"job": "job-xxxx"
}
}
Calling app-BFG5k2009PxyvYXBBJY00BK1 with output destination
project-xxxx:/
Job ID: job-xxxx
Automatically Run a Command After a Job Finishes
You can use the command
dx wait to wait for a job to finish. If we run the following command right after running the Freebayes app, it will show you the recent jobs only after the job has finished, as shown in the example below.$ dx wait job-xxxx && dx find jobs
Waiting for job-xxxx to finish running...
Done
* FreeBayes Variant Caller (done) job-xxxx
user-amy 2017-01-01 09:00:00 (runtime 0:05:24)
...
Congratulations! You have now called variants on a reads sample, and you did it all on the command line. Now let's look at how you can automate this process.
The beauty of the CLI is the ability to automate processes. In fact, we can automate everything we just did. The following script assumes that you've already logged in and is hardcoded to use the ce10 genome and takes in a local gzipped FASTQ file as its command-line argument.
#!/usr/bin/env bash
# Usage: <script_name.sh> local_fastq_filename.fastq.gz
reference="Reference Genome Files\: AWS US (East):/C. Elegans - Ce10/ce10.fasta.gz"
bwa_indexed_reference="Reference Genome Files\: AWS US (East):/C. Elegans - Ce10/ce10.bwa-index.tar.gz"
local_reads_file="$1"
reads_file_id=$(dx upload "$local_reads_file" --brief)
bwa_job=$(dx run bwa_mem_fastq_read_mapper -ireads_fastqgzs=$reads_file_id -igenomeindex_targz="$bwa_indexed_reference" -y --brief)
freebayes_job=$(dx run freebayes -isorted_bams=$bwa_job:sorted_bam -igenome_fastagz="$reference" -y --brief)
dx wait $freebayes_job
dx download $freebayes_job:variants_vcfgz -o "$local_reads_file".vcf.gz
gunzip "$local_reads_file".vcf.gz
You're now ready to start scripting using
dx. As shown in some of the examples above, the --brief flag can come in handy for scripting. A list of all dx commands and flags is on the Index of dx Commands page.For more detailed information about running apps and applets from the command line, see the Running Apps and Applets page.
Last modified 3mo ago