# Command Line Quickstart

{% hint style="info" %}
You must set up billing for your account before you can perform an analysis, or upload or egress data. [Follow these instructions to set up billing](https://documentation.dnanexus.com/admin/billing-and-account-management).
{% endhint %}

The `dx` command-line client is included in the [DNAnexus SDK (`dx-toolkit`)](https://documentation.dnanexus.com/downloads#dnanexus-platform-sdk). You can use the `dx` client to log into the Platform, to upload, browse, and organize data, and to launch analyses.

All the projects and data referenced in this Quickstart are publicly available, so you can follow along step-by-step.

## Before You Begin

If you haven't already done so, [download and install the DNAnexus Platform toolkit](https://documentation.dnanexus.com/downloads), which includes the `dx` command-line client, as well as range of useful utilities.

### Getting Help

As you work, use the [index of `dx` commands](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities) as a reference.

On the command line, you can also enter `dx help` to see a list of commands, broken down by category. To see a list of commands from a particular category, enter `dx help <category>`.

To learn what a particular command does, enter `dx help <command>`, `dx <command> -h`, or `dx <command> -help` . For example, enter `dx help ls` to learn about the command `dx ls`:

```shell
$ dx help ls
usage: dx ls [-h] [--color {off,on,auto}] [--delimiter [DELIMITER]]
[--env-help] [--brief | --summary | --verbose] [-a] [-l] [--obj]
[--folders] [--full]
[path]

List folders and/or objects in a folder
... # output truncated for brevity
```

## Step 1: Log In

The first step is to [log in](https://documentation.dnanexus.com/user/login-and-logout). If you have not created a DNAnexus account, open the [DNAnexus Platform](https://platform.dnanexus.com) and sign up. User signup is not supported on the command line.

```shell
$ dx login
Acquiring credentials from https://auth.dnanexus.com
Username: <your username>
Password: <your password>

No projects to choose from. You can create one with the command "dx new project".
To pick from projects for which you only have VIEW permissions, use "dx select --level VIEW" or "dx select --public".
```

Your [authentication token](https://documentation.dnanexus.com/user/login-and-logout#generating-a-token) and your current project settings are saved in a local configuration file, and you can start accessing your project.

{% hint style="info" %}
You can generate an authentication token from the online DNAnexus Platform [using the UI](https://documentation.dnanexus.com/user/login-and-logout#generating-a-token).
{% endhint %}

## Step 2: Explore

### Public Projects

Look inside some public projects that have already been set up. From the command line, enter the command:

```shell
dx select --public --name "Reference Genome Files*"
```

By running the [`dx select`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#select) command and picking a project, you perform the command-line equivalent of going to the project page for [**Reference Genome Files: AWS US (East)**](https://platform.dnanexus.com/projects/BQpp3Y804Y0xbyG4GJPQ01xv/data) (platform login required to access this link) on the website. This is a DNAnexus-sponsored project containing popular genomes for use in analyses with your own data.

For more information about the `dx select` command, see the [Changing Your Current Project](https://documentation.dnanexus.com/user/projects/project-navigation#changing-your-current-project) page.

{% hint style="info" %}
DNAnexus-sponsored data is free to copy from this project as many times as needed.
{% endhint %}

List the data in the top-level directory of the project you've selected by running the command [`dx ls`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#ls). View the contents of a folder by running the command `dx ls <folder_name>`.

```shell
$ dx ls
C. Elegans - Ce10/
D. melanogaster - Dm3/
H. Sapiens - GRCh37 - b37 (1000 Genomes Phase I)/
H. Sapiens - GRCh37 - hs37d5 (1000 Genomes Phase II)/
H. Sapiens - GRCh38/
H. Sapiens - hg19 (Ion Torrent)/
H. Sapiens - hg19 (UCSC)/
M. musculus - mm10/
M. musculus - mm9/
$ dx ls "C. Elegans - Ce10/"
ce10.bt2-index.tar.gz
ce10.bwa-index.tar.gz
... # output truncated for brevity
```

{% hint style="info" %}
When you use wildcard characters like `*` or `?` with `dx` commands, always enclose the pattern in quotes. For example, use `dx ls "*.fastq"`. Without quotes, your shell expands the wildcards against local files before passing them to `dx`. This produces unexpected results. For details, see [Quoting Wildcards in Shell Commands](https://documentation.dnanexus.com/user/objects/searching-data-objects#quoting-wildcards-in-shell-commands).
{% endhint %}

You can avoid typing out the full name of the folder by typing in `dx ls C` and then pressing `<TAB>`. The folder name auto-completes from there.

You don't have to be in a project to inspect its contents. You can also look into another project, and a folder within the project, by giving the project name or ID, followed by a colon (`:`) and the folder path. Here, the contents of the publicly available project "Demo Data" are listed using both its name and ID.

```shell
$ dx ls "Demo Data:/SRR100022/"
SRR100022_1.filt.fastq.gz
SRR100022_2.filt.fastq.gz
$ dx ls -l "project-BQbJpBj0bvygyQxgQ1800Jkk:/SRR100022/"
Project: Demo Data (project-BQbJpBj0bvygyQxgQ1800Jkk)
Folder : /SRR100022
State   Last modified       Size     Name (ID)
... # output truncated for brevity
```

As shown above, you can use the `-l` flag with `dx ls` to list more details about files, such as the time a file was last modified, its size (if applicable), and its full DNAnexus ID.

### Describing DNAnexus Objects

You can use the [`dx describe`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#describe) command to learn more about [files and other objects](https://documentation.dnanexus.com/getting-started/key-concepts/projects) on the platform. Given a DNAnexus object ID or name, `dx describe` returns detailed information about the object. `dx describe` only returns results for data objects to which you have access.

Besides describing data and projects (examples for which are shown below), you can also describe apps, jobs, and users.

#### Describing a File

Below, the reference genome file for *C. Elegans* located in the "Reference Genome Files: AWS US (East)" project that has been used is described (which should be accessible from other regions as well). You need to add a colon (:) after the project name, here that would be `Reference Genome Files\: AWS US (East):` .

```shell
$ dx describe "Reference Genome Files\: AWS US (East):/C. Elegans - Ce10/ce10.fasta.gz"
Result 1:
ID                  file-BQbY9Bj015pB7JJVX0vQ7vj5
Class               file
Project             project-BQpp3Y804Y0xbyG4GJPQ01xv
Folder              /C. Elegans - Ce10
Name                ce10.fasta.gz
State               closed
Visibility          visible
Types               -
Properties          Assembly=UCSC ce10,
                    Origin=https://hgdownload.cse.ucsc.edu/goldenPath/ce10/bigZips/ce10.2bit,
                    Species=Caenorhabditis elegans,
                    Taxonomy
                    ID=6239
Tags                -
Outgoing links      -
Created             Tue Sep 30 18:54:35 2014
Created by          bhannigan
 via the job        job-BQbY8y80KKgP380QVQY000qz
Last modified       Thu Mar  2 12:17:27 2017
Media type          application/x-gzip
archivalState       "live"
Size                29.21 MB, sponsored by DNAnexus
```

#### Describing a Project

Below, the publicly available Reference Genome Files project that has been used is described.

```shell
$ dx describe "Reference Genome Files\: AWS US (East):"
Result 1:
ID                  project-BQpp3Y804Y0xbyG4GJPQ01xv
Class               project
Name                Reference Genome Files: AWS US (East)
Summary             
Billed to           org-dnanexus
Access level        VIEW
Region              aws:us-east-1
Protected           true
Restricted          false
Contains PHI        false
Created             Wed Oct  8 16:42:53 2014
Created by          tnguyen
Last modified       Tue Oct 23 14:15:59 2018
Data usage          0.00 GB
Sponsored data      519.77 GB
Sponsored egress    0.00 GB used of 0.00 GB total
Tags                -
Properties          -
downloadRestricted  false
defaultInstanceType "mem2_hdd2_x2"
```

## Step 3: Create Your Own Project

Use the command [`dx new project`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#new-project) to create a new project.

```shell
$ dx new project "My First Project"
Created new project called "My First Project"
(project-xxxx)
Switch to new project now? [y/N]: y
```

The text *project-xxxx* denotes a placeholder for a unique, immutable project ID. For more information about object IDs, see the [Entity IDs](https://documentation.dnanexus.com/developer/api/entity-ids) page.

The project is ready for uploading data and running analyses.

{% hint style="info" %}
The `new` command can also allow you to create other new data objects, including new orgs or users. Use the command `dx help new` to see additional information. For mode information, see the [full list of `dx` commands](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities).
{% endhint %}

## Step 4: Upload and Manage Your Data

To analyze a sample, use the [`dx upload`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#upload) command or the [Upload Agent](https://documentation.dnanexus.com/user/objects/uploading-and-downloading-files/batch/upload-agent) if installed. For this tutorial, download the file [`small-celegans-sample.fastq`](https://dl.dnanex.us/F/D/Bp43z7pb2JX8jpB035j4424Vp4Y6qpQ6610ZXg5F/small-celegans-sample.fastq), which represents the first 25000 *C. elegans* reads from SRR070372. This file is used in the sample analysis below.

For uploading multiple or large files, use the [Upload Agent](https://documentation.dnanexus.com/user/objects/uploading-and-downloading-files/batch/upload-agent). It compresses files and uploads them in parallel over multiple HTTP connections and supports resumable uploads.

The following command uploads the `small-celegans-sample.fastq` file into the current directory of the current project. The `--wait` flag tells [`dx upload`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#upload) to wait until uploading is complete before returning the prompt and describing the result.

```shell
$ dx upload --wait small-celegans-sample.fastq
[===========================================================>] Uploaded (16801690 of 16801690 bytes) 100% small-celegans-sample.fastq
ID              file-xxxx
Class           file
Project         project-xxxx
Folder          /
Name            small-celegans-sample.fastq
State           closed
Visibility      visible
Types           -
Properties      -
Tags            -
Details         {}
Outgoing links  -
Created         Sun Jan  1 09:00:00 2017
Created by      amy
Last modified   Sat Jan  1 09:00:00 2017
Media type      text/plain
Size            16.02 MB
```

{% hint style="info" %}
If you run the same command but add the flag `--brief`, only the file ID (in the form of *file-xxxx*) is printed to the terminal. Other `dx` commands also accept the `--brief` flag and report only object IDs.
{% endhint %}

### Examining Data

To take a quick look at the first few lines of the file you uploaded, use the [`dx head`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#head) command. By default, it prints the first 10 lines of the given file.

Run it on the file you uploaded and use the `-n` flag to ask for the first 12 lines (the first 3 reads) of the FASTQ file.

```shell
$ dx head -n 12 small-celegans-sample.fastq
@SRR070372.1 FV5358E02GLGSF length=78
TTTTTTTTTTTTTTTTTTTTTTTTTTTNTTTNTTTNTTTNTTTATTTATTTATTTATTATTATATATATATATATATA
+SRR070372.1 FV5358E02GLGSF length=78
...000//////999999<<<=<<666!602!777!922!688:669A9=<=122569AAA?>@BBBBAA?=<96632
@SRR070372.2 FV5358E02FQJUJ length=177
TTTCTTGTAATTTGTTGGAATACGAGAACATCGTCAATAATATATCGTATGAATTGAACCACACGGCACATATTTGAACTTGTTCGTGAAATTTAGCGAACCTGGCAGGACTCGAACCTCCAATCTTCGGATCCGAAGTCCGACGCCCCCGCGTCGGATGCGTTGTTACCACTGCTT
+SRR070372.2 FV5358E02FQJUJ length=177
222@99912088>C<?7779@<GIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIC;6666IIIIIIIIIIII;;;HHIIE>944=>=;22499;CIIIIIIIIIIIIHHHIIIIIIIIIIIIIIIH?;;;?IIEEEEEEEEIIII77777I7EEIIEEHHHHHIIIIIIIIIIIIII
@SRR070372.3 FV5358E02GYL4S length=70
TTGGTATCATTGATATTCATTCTGGAGAACGATGGAACATACAAGAATTGTGTTAAGACCTGCATAAGGG
+SRR070372.3 FV5358E02GYL4S length=70
@@@@@DFFFFFHHHHHHHFBB@FDDBBBB=?::5555BBBBD??@?DFFHHFDDDDFFFDDBBBB<<410
```

### Downloading Data

If you'd like to download a file from the platform, use the [`dx download`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#download) command. This command uses the name of the file for the filename unless you specify your own with the `-o` or `--output` flag. The example below downloads the same *C. elegans* file that was uploaded previously.

```shell
$ dx download small-celegans-sample.fastq
[                                                            ] Downloaded 0 byte
[===========================================================>] Downloaded 16.02 of
[===========================================================>] Completed 16.02 of 16.02 bytes (100%) small-celegans-sample.fastq
```

### About Metadata

Files have different available fields for metadata, such as "properties" (key-value pairs) and "tags".

## Step 5: Analyze a Sample

For the next few steps, if you would like to follow along, you need a *C. elegans* FASTQ file. This tutorial maps the reads against the ce10 genome. If you haven't already, you can download and use the following FASTQ file, which contains the first 25,000 reads from SRR070372: [`small-celegans-sample.fastq`](https://dl.dnanex.us/F/D/Bp43z7pb2JX8jpB035j4424Vp4Y6qpQ6610ZXg5F/small-celegans-sample.fastq).

{% hint style="info" %}
You can also substitute your own reads file for a different species (though it may take longer to run the example). For convenience, DNAnexus has already imported a variety of reference genomes to the platform. If you have a FASTA file to use, upload it and create genome indices for BWA using the [BWA FASTA Indexer app](https://platform.dnanexus.com/app/bwa_fasta_indexer) (platform login required to access these links).
{% endhint %}

The following walkthrough explains what each command does and shows which apps run. If you only want to convert a gzipped FASTQ file to a VCF via BWA and the FreeBayes Variant Caller, [skip ahead to the Automate It section](#automation) to see the commands required to run the apps.

### Uploading Reads

If you have not yet done so, you can upload a FASTQ file for analysis.

```shell
dx upload small-celegans-sample.fastq --wait
```

For more information about using the command [`dx upload`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#upload), see the [`dx upload`](https://documentation.dnanexus.com/user/objects/uploading-and-downloading-files/small-sets-of-files/uploading-using-dx) page.

### Mapping Reads

Next, use the [BWA-MEM app](https://platform.dnanexus.com/app/bwa_mem_fastq_read_mapper) (platform login required to access this link) to map the uploaded reads file to a reference genome.

### Finding the App Name

If you don't know the command-line name of the app to run, you have two options:

1. Navigate to its web page from the [Apps page](https://platform.dnanexus.com/apps) (platform login required to access this link). The app's page shows how to run it from the command line. See the [BWA-MEM FASTQ Read Mapper page](https://platform.dnanexus.com/app/bwa_mem_fastq_read_mapper) for details on the app used here (platform login required).
2. Alternatively, search for apps from the command line by running `dx find apps`. The command-line name appears in parentheses in the output (underlined below).

```shell
$ dx find apps
...
x BWA-MEM FASTQ Read Mapper (bwa_mem_fastq_read_mapper), v1.4.0
...
```

### Installing and Running the App

Install the app using [`dx install`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#install) and check that it has been installed. While you do not always need to install an app to run it, you may find it useful as a bookmarking tool.

```shell
$ dx install bwa_mem_fastq_read_mapper
Installed the bwa_mem_fastq_read_mapper app
$ dx find apps --installed
BWA-MEM FASTQ Read Mapper (bwa_mem_fastq_read_mapper), v1.4.0
```

You can run the app using [`dx run`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#run). When you run it without any arguments, it prompts you for required and then optional arguments. The reference file `genomeindex_targz` for this *C. elegans* sample is in a `.tar.gz` format and can be found in the Reference Genome folder of the region your project is in.

```shell
$ dx run bwa_mem_fastq_read_mapper
Entering interactive mode for input selection.

Input:   Reads (reads_fastqgz)
Class:   file
Enter file ID or path (<TAB> twice for compatible files in current directory,'?' for help)
reads_fastqgz[0]: <small-celegans-sample.fastq.gz>

Input:   BWA reference genome index (genomeindex_targz)
Class:   file

Suggestions:
project-BQpp3Y804Y0xbyG4GJPQ01xv://file-\* (DNAnexus Reference Genomes)
Enter file ID or path (<TAB> twice for compatible files in current
directory,'?' for more options)
genomeindex_targz: <"Reference Genome Files\: <REGION_OF_PROJECT>:/C. Elegans - Ce10/ce10.bwa-index.tar.gz">

Select an optional parameter to set by its # (^D or <ENTER> to finish):

[0] Reads (right mates) (reads2_fastqgz)
[1] Add read group information to the mappings (required by downstream GATK)? (add_read_group) [default=true]
[2] Read group id (read_group_id) [default={"$dnanexus_link": {"input": "reads_fastqgz", "metadata": "name"}}]
[3] Read group platform (read_group_platform) [default="ILLUMINA"]
[4] Read group platform unit (read_group_platform_unit) [default="None"]
[5] Read group library (read_group_library) [default="1"]
[6] Read group sample (read_group_sample) [default="1"]
[7] Output all alignments for single/unpaired reads? (all_alignments)
[8] Mark shorter split hits as secondary? (mark_as_secondary) [default=true]
[9] Advanced command line options (advanced_options)

Optional param #: <ENTER>

Using input JSON:
{
    "reads_fastqgz": {
        "$dnanexus_link": {
            "project": "project-B3X8bjBqqBk1y7bVPkvQ0001",
            "id": "file-B3P6v02KZbFFkQ2xj0JQ005Y"
        }

"genomeindex_targz": {
        "$dnanexus_link": {
            "project": "project-xxxx(project ID for the reference genome in your region)",
            "id": "file-BQbYJpQ09j3x9Fj30kf003JG"
        }
    }
}

Confirm running the applet/app with this input [Y/n]: <ENTER>
Calling app-BP2xVx80fVy0z92VYVXQ009j with output destination
     project-xxxx:/

Job ID: job-xxxx
```

### Monitoring Your Job

You can use the command [`dx watch`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#watch) to monitor jobs. The command prints out the log file of the job, including the `STDOUT`, `STDERR`, and `INFO` printouts.

You can also use the command `dx describe job-xxxx` to learn more about your job. If you don't know the job's ID, you can use the command [`dx find jobs`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#find-jobs) to list all the jobs run in the current project, along with the user who ran them, their status, and when they began.

```shell
$ dx find jobs
* BWA-MEM FASTQ Read Mapper (bwa_mem_fastq_read_mapper:main)(done) job-xxxx
user-amy 20xx-xx-xx 0x:00:00 (runtime 0:00:xx)
$ dx describe job-xxxx
...
```

Additional options are available to restrict your search of previous jobs, such as by their names or when they were run.

### Terminating Your Job

If for some reason you need to terminate your job before it completes, use the command [`dx terminate`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#terminate).

### After Your Job Finishes

You should see two new files in your project: the mapped reads in a BAM file, and an index of that BAM file with a `.bai` extension. You can refer to the output file by name or by the job that produced it using the syntax `job-xxxx:<output field>`. Try it yourself with the job ID you got from calling the BWA-MEM app!

```shell
$ dx ls
small-celegans-sample.bam
small-celegans-sample.bam.bai
small-celegans-sample.fastq
$ dx describe small-celegans-sample.bam
...
$ dx describe job-xxxx:sorted_bam
...
```

#### Variant Calling

You can use the [FreeBayes Variant Caller app](https://platform.dnanexus.com/app/freebayes) (platform login required to access this link) to call variants on your BAM file.

This time, instead of relying on interactive mode to enter inputs, you provide them directly. First, look up the app's spec to determine the input names. Run the command `dx run freebayes -h`.

```
usage: dx run freebayes [-iINPUT_NAME=VALUE ...]

App: FreeBayes Variant Caller

Version: 3.0.1 (published)

Calls variants (SNPs, indels, and other events) using FreeBayes

See the app page for more information:
  https://platform.dnanexus.com/app/freebayes

Inputs:
  Sorted mappings: -isorted_bams=(file) [-isorted_bams=... [...]]
        One or more coordinate-sorted BAM files containing mappings to call
        variants for.

  Genome: -igenome_fastagz=(file)
        A file, in gzipped FASTA format, with the reference genome that the
        reads were mapped against.

        Suggestions:
          project-BQpp3Y804Y0xbyG4GJPQ01xv://file-* (DNAnexus Reference Genomes: AWS US (East))
          project-F3zxk7Q4F30Xp8fG69K1Vppj://file-* (DNAnexus Reference Genomes: AWS Germany)
          project-F0yyz6j9Jz8YpxQV8B8Kk7Zy://file-* (DNAnexus Reference Genomes: Azure US (West))
          project-F4gXb605fKQyBq5vJBG31KGG://file-* (DNAnexus Reference Genomes: AWS Sydney)
          project-FGX8gVQB9X7K5f1pKfPvz9yG://file-* (DNAnexus Reference Genomes: Azure Amsterdam)
          project-GvGXBbk36347jYPxP0j755KZ://file-* (DNAnexus Reference Genomes: Bahrain)

  Target regions: [-itargets_bed=(file)]
        (Optional) A BED file containing the coordinates of the genomic
        regions to intersect results with. Supplying this will cause 'bcftools
        view -R' to be used, to limit the results to that subset. This option
        does not speed up the execution of FreeBayes.

        Suggestions:
          project-B6JG85Z2J35vb6Z7pQ9Q02j8:/vendor_exomes/file-* (Vendor Exomes (GRCh37 and hg19): AWS US (East))
          project-F3zqGV04fXX5j7566869fjFq:/vendor_exomes/file-* (Vendor Exomes (GRCh37 and hg19): AWS Germany)
          project-F29g0xQ90fvQf5z1BX6b5106:/vendor_exomes/file-* (Vendor Exomes (GRCh37 and hg19): Azure US (West))
          project-F4gYG1850p1JXzjp95PBqzY5:/vendor_exomes/file-* (Vendor Exomes (GRCh37 and hg19): AWS Sydney)
          project-FGXfq9QBy7Zv5BYQ9Yvqj9Xv:/vendor_exomes/file-* (Vendor Exomes (GRCh37 and hg19): Azure Amsterdam)
          project-GvGXBZk3f624QVfBPjB8916j:/vendor_exomes/file-* (Vendor Exomes (GRCh37 and hg19): Bahrain)

 Common
  Output prefix: [-ioutput_prefix=(string)]
        (Optional) The prefix to use when naming the output files (they will
        be called prefix.vcf.gz, prefix.vcf.gz.tbi). If not provided, the
        prefix will be the same as the first BAM file given.

  Apply standard filters?: [-istandard_filters=(boolean, default=true)]
        Select this to use stringent input base and mapping quality filters,
        which may reduce false positives. This will supply the
        '--standard-filters' option to FreeBayes.

  Normalize variants representation?: [-inormalize_variants=(boolean, default=true)]
        Select this to use 'bcftools norm' in order to normalize the variants
        representation, which may help with downstream compatibility.

  Perform parallelization?: [-iparallelized=(boolean, default=true)]
        Select this to parallelize FreeBayes using multiple threads. This will
        use the 'freebayes-parallel' script from the FreeBayes package, with a
        granularity of 3 million base pairs. WARNING: This option may be
        incompatible with certain advanced command-line options.

 Advanced
  Report genotype qualities?: [-igenotype_qualities=(boolean, default=false)]
        Select this to have FreeBayes report genotype qualities.

  Add RG tags to BAM files?: [-ibam_add_rg=(boolean, default=false)]
        Select this to have FreeBayes add read group tags to the input BAM
        files so each file will be treated as an individual sample. WARNING:
        This may increase the memory requirements for FreeBayes.

  Advanced command line options: [-iadvanced_options=(string)]
        (Optional) Advanced command line options that will be supplied
        directly to the FreeBayes program.

Outputs:
  Variants: variants_vcfgz (file)
        A bgzipped VCF file with the called variants.

  Variants index: variants_tbi (file)
        A tabix index (TBI) file with the associated variants index.
```

*Optional* inputs are shown using square brackets (`[]`) around the command-line syntax for each input. Notice that there are two required inputs that must be specified:

1. Sorted mappings (`sorted_bams`): A list of files with a `.bam` extension.
2. Genome (`genome_fastagz`): A reference genome in FASTA format that has been gzipped.

{% hint style="info" %}
You can also run `dx describe freebayes` for a more compact view of the input and output specifications. By default, it hides the advanced input options, but you can view them using the `--verbose` flag.
{% endhint %}

#### Running the App with a One-Liner Using a Job-Based Object Reference

It is sometimes more convenient to run apps using a single one-line command. You can do this by specifying all the necessary inputs either via the command line or in a prepared file. Use the `-i` flag to specify inputs as suggested by the output of `dx run freebayes ‑h`:

* `sorted_bams`: The output of the previous BWA step (see the [Map Reads](#mapping-reads) section for more information).
* `genome_fastagz`: The ce10 genome in the Reference Genomes project.

To specify new job input using the output of a previous job, use a [*job-based object reference*](https://documentation.dnanexus.com/faqs/developing-apps-and-applets#what-are-job-based-object-references-jbors-and-how-can-i-use-them-when-running-apps) via the `job-xxxx:<output field>` syntax used earlier.

{% hint style="info" %}
You can use job-based object references as input even *before* the referenced jobs have finished. The system waits until the input is ready to begin the new job.
{% endhint %}

Replace the job ID below with that generated by the BWA app you ran earlier. The `-y` flag skips the input confirmation.

```shell
$ dx run freebayes -y \
 -igenome_fastagz=Reference\ Genome\ Files:/C.\ Elegans\ -\ Ce10/ce10.fasta.gz \
 -isorted_bams=job-xxxx:sorted_bam

Using input JSON:
{
  "genome_fastagz": {
    "$dnanexus_link": {
      "project": "project-xxxx",
      "id": "file-xxxx"
    }
  },
  "sorted_bams": {
    "field": "sorted_bam",
    "job": "job-xxxx"
  }
}

Calling app-BFG5k2009PxyvYXBBJY00BK1 with output destination
project-xxxx:/

Job ID: job-xxxx
```

#### Automatically Running a Command After a Job Finishes

Use the command [`dx wait`](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities#wait) to wait for a job to finish. If you run the following command immediately after launching the FreeBayes app, it shows recent jobs only after the job has finished, as shown in the example below.

```shell
$ dx wait job-xxxx && dx find jobs
Waiting for job-xxxx to finish running...
Done
* FreeBayes Variant Caller (done) job-xxxx
user-amy 2017-01-01 09:00:00 (runtime 0:05:24)
...
```

Congratulations! You have called variants on a reads sample using the command line. Next, see how to automate this process.

#### Automation

The CLI enables automation of these steps. The following script assumes that you are logged in. It is hardcoded to use the ce10 genome and takes a local gzipped FASTQ file as its command-line argument.

```shell
#!/usr/bin/env bash
# Usage: <script_name.sh> local_fastq_filename.fastq.gz

reference="Reference Genome Files\: AWS US (East):/C. Elegans - Ce10/ce10.fasta.gz"
bwa_indexed_reference="Reference Genome Files\: AWS US (East):/C. Elegans - Ce10/ce10.bwa-index.tar.gz"
local_reads_file="$1"

reads_file_id=$(dx upload "$local_reads_file" --brief)
bwa_job=$(dx run bwa_mem_fastq_read_mapper -ireads_fastqgzs=$reads_file_id -igenomeindex_targz="$bwa_indexed_reference" -y --brief)
freebayes_job=$(dx run freebayes -isorted_bams=$bwa_job:sorted_bam -igenome_fastagz="$reference" -y --brief)

dx wait $freebayes_job

dx download $freebayes_job:variants_vcfgz -o "$local_reads_file".vcf.gz
gunzip "$local_reads_file".vcf.gz
```

## Learn More

You can start scripting using `dx`. The `--brief` flag is useful for scripting. A list of all `dx` commands and flags is on the [Index of `dx` Commands](https://documentation.dnanexus.com/user/helpstrings-of-sdk-command-line-utilities) page.

For more detailed information about running apps and applets from the command line, see the [Running Apps and Applets](https://documentation.dnanexus.com/user/running-apps-and-workflows/running-apps-and-applets) page.

For a comprehensive guide to the DNAnexus SDK, see the [SDK documentation](https://documentation.dnanexus.com/developer/client-libraries).

Want to start writing your own apps? Check out the [Developer Portal](https://documentation.dnanexus.com/developer) for some useful tutorials.
