# Introduction to Building Apps

## Applets and Apps

Applets and apps are types of executables that can be run on the DNAnexus Platform. They differ in key ways, notably in the context in which each can be used:

* Applets are data objects, which live inside Platform projects.
* Apps do not live inside projects, and can be published to allow other users to run them in projects of their choosing.

Applets and apps are created in the same way, up until the final build step. At this step, the developer specifies whether the executable should be an applet or an app. You can also [convert applets to apps](https://documentation.dnanexus.com/developer/transitioning-from-applets-to-apps#making-the-transition).

For more on the difference between applets and apps, see [differences between applets and apps](https://documentation.dnanexus.com/developer/transitioning-from-applets-to-apps#differences-between-applets-and-apps).

## Overview

In this tutorial, you learn to create an applet based on an existing executable: FastQTrimmer, one of the [FASTX-Toolkit collection](http://hannonlab.cshl.edu/fastx_toolkit/) of command-line tools for processing short-reads FASTA and FASTQ files. You then use the applet to run FastQTrimmer on a FASTQ file, creating a trimmed reads file that you can then use for further analysis.

Figure 1 shows how you could run FastQTrimmer on your local machine, to process a sequence file in a project on the Platform. You would need to 1) use `dx download` to download the source file to your local machine, then 2) process it using the `fastq_quality_trimmer` executable called FastQTrimmer, 3) use `dx upload` to upload the new trimmed reads file to 4) a project on the Platform.

![Figure 1](https://1612471957-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2F-L_EsL_ie8XyZlLe_yf9%2Fuploads%2Fgit-blob-98c1ddd042154f30372d3579fa0b352560eb2772%2Flocal-analysis.png?alt=media)

By turning FastQTrimmer into an applet, you make this process much simpler and quicker. You don't have to download or upload anything, and you can take advantage of the power of the Platform, in running FastQTrimmer.

As shown in Figure 2, you can use two DNAnexus utilities when creating your applet: `dx-app-wizard` (1) creates a skeleton directory for the applet, while `dx build` (2) adds the applet to the Platform as a data object (3) in your project.

![Figure 2](https://1612471957-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2F-L_EsL_ie8XyZlLe_yf9%2Fuploads%2Fgit-blob-058ec5e98ca83e0d90f36ca8ff149cbb8f5d8c50%2Fbuild-applet.png?alt=media)

## Before You Begin

Before beginning this tutorial, [download and install `dx-toolkit`](https://documentation.dnanexus.com/downloads#dnanexus-platform-sdk). If you haven't already done so, you may also want to run through the [Command Line Quickstart](https://documentation.dnanexus.com/getting-started/cli-quickstart). You should also make sure that you're logged into the DNAnexus Platform, ideally [using an API token](https://documentation.dnanexus.com/user/login-and-logout#using-tokens), to prevent your being logged off before you've finished building your applet.

## Step 1. Initial Downloads

Begin by downloading both:

* The [FASTX-Toolkit for 64-bit Linux](http://hannonlab.cshl.edu/fastx_toolkit/fastx_toolkit_0.0.13_binaries_Linux_2.6_amd64.tar.bz2)
* A sample [FASTQ file](https://dl.dnanex.us/F/D/Bp43z7pb2JX8jpB035j4424Vp4Y6qpQ6610ZXg5F/small-celegans-sample.fastq\&sa=D\&source=docs\&ust=1649115551526973\&usg=AOvVaw3Svi0dBfUALYnH6G0TbTth) containing the first 25,000 reads from a C. elegans sample ([SRR070372](https://www.ncbi.nlm.nih.gov/sra/?term=SRR070372)).

## Step 2. Run the App Wizard

Next, you need to create a local directory and a source code template for your applet. While [you can do this manually](https://documentation.dnanexus.com/developer/apps/advanced-app-tutorial), the App Wizard enables you to do so via a guided workflow in a few steps. Following is a walkthrough of this workflow, along with detail on how to respond to prompts from the Wizard:

1. Launch the App Wizard from the CLI by entering: `dx-app-wizard`
2. When prompted for the app name, enter: `mytrimmer`
3. (Optional) Enter a title for your applet, or press Enter to skip.
4. (Optional) Enter a summary for your applet, or press Enter to skip.
5. Enter a version number, or press Enter to accept the default (`0.0.1`).
6. For the first input parameter, enter: `input_file`
7. (Optional) Enter a label for the input parameter, or press Enter to skip.
8. Select `file` as the input parameter class type.
9. When asked if the parameter is optional, enter: `n`
10. Press Enter to finish entering input parameters.
11. For the output parameter, enter: `output_file`
12. (Optional) Enter a label for the output parameter, or press Enter to skip.
13. Select `file` as the output parameter class type.
14. Press Enter to finish entering output parameters.
15. Set a timeout policy, or press Enter to accept the default (48h).
16. When prompted for the programming language, enter: `bash`
17. For all remaining prompts (template options, access permissions, instance type), press Enter to accept the defaults.

The App Wizard finishes by creating a local directory called `mytrimmer`.

Here's how this all looks, from the CLI:

```shell
$ dx-app-wizard
DNAnexus App Wizard, API v1.0.0
[...]

The name of your app must be unique on the DNAnexus Platform. After creating your app for the
 first time, you will be able to publish new versions using the same app name. App names are
restricted to alphanumeric characters (a-z, A-Z, 0-9), and the characters ".", "\_", and "-".

App Name: mytrimmer

[...] (Press <ENTER> to accept defaults)

Input Specification

You will now be prompted for each input parameter to your app. Each parameter should have a
 unique name that uses only the underscore "\_" and alphanumeric characters, and does not
 start with a number.

1st input name (<ENTER> to finish): input_file
Label (optional human-readable name) []: <ENTER>
Your input variable must be of one of the following classes:
applet         array:file     array:record   file           int     
array:applet   array:float    array:string   float          record         
array:boolean  array:int      boolean        hash           string      

Choose a class (<TAB> twice for choices): file
This is an optional parameter [y/n]: n

2nd input name (<ENTER> to finish): <ENTER>

Output Specification

You will now be prompted for each output parameter of your app. Each parameter should have
a unique name that uses only the underscore "\_" and alphanumeric characters, and does not
start with a number.

1st output name (<ENTER> to finish): output_file
Label (optional) []: <ENTER>
Your output parameter must be of one of the following classes:
applet         array:file     array:record   file           int
array:applet   array:float    array:string   float          record
array:boolean  array:int      boolean        hash           string
Choose a class (<TAB> twice for choices): file

2nd output name (<ENTER> to finish): <ENTER>

Timeout Policy

Set a timeout policy for your app. Any single entry point of the app that runs longer than
the specified timeout will fail with a TimeoutExceeded error. Enter an int greater than 0
with a single-letter suffix (m=minutes, h=hours, d=days) (e.g. "48h").

Timeout policy [48h]: <ENTER>

Template Options

You can write your app in any programming language, but we provide templates for the
following supported languages: Python, bash
Programming language: (Enter either Python or bash)

Access Permissions
If you request these extra permissions for your app, users will see this fact when launching
your app, and certain other restrictions will apply. For more information, see
https://documentation.dnanexus.com/developer/apps/app-permissions.

Access to the Internet (other than accessing the DNAnexus API).
Will this app need access to the Internet? [y/N]: (Enter y for Internet connection, or n for no Internet connection)

Direct access to the parent project. This is not needed if your app specifies outputs,which will be copied into the project after it's done running.
Will this app need access to the parent project? [y/N]: (Enter y for direct access, or n for no access)

System Requirements

Common AWS instance types:
┌─────────────┬─────────┬──────────┬─────────┐
│Name         │Memory_GB│Storage_GB│CPU_Cores│
├─────────────┼─────────┼──────────┼─────────┤
│mem1_ssd1_x2 │3.8      │32        │2        │
│mem1_ssd1_x4 │7.5      │80        │4        │
│mem1_ssd1_x8 │15.0     │160       │8        │
│mem1_ssd1_x16│30.0     │320       │16       │
│mem1_ssd1_x32│60.0     │640       │32       │
│mem2_ssd1_x2 │7.5      │32        │2        │
│mem2_ssd1_x4 │15.0     │80        │4        │
│mem2_ssd1_x8 │30.0     │160       │8        │
│mem3_ssd1_x2 │15.0     │32        │2        │
│mem3_ssd1_x4 │30.5     │80        │4        │
│mem3_ssd1_x8 │61.0     │160       │8        │
│mem3_ssd1_x16│122.0    │320       │16       │
│mem3_ssd1_x32│244.0    │640       │32       │
│mem1_ssd2_x2 │3.8      │160       │2        │
│mem1_ssd2_x4 │7.5      │320       │4        │
│mem1_ssd2_x8 │15       │640       │8        │
│mem1_ssd2_x16│30       │1280      │16       │
│mem1_ssd2_x36│60       │2880      │36       │
└─────────────┴─────────┴──────────┴─────────┘
Common Azure instance types:
┌───────────────────┬─────────┬──────────┬─────────┐
│Name               │Memory_GB│Storage_GB│CPU_Cores│
├───────────────────┼─────────┼──────────┼─────────┤
│azure:mem1_ssd1_x2 │3.9      │32        │2        │
│azure:mem1_ssd1_x4 │7.8      │64        │4        │
│azure:mem1_ssd1_x8 │15.7     │128       │8        │
│azure:mem1_ssd1_x16│31.4     │256       │16       │
│azure:mem2_ssd1_x1 │3.5      │128       │1        │
│azure:mem2_ssd1_x2 │7.0      │128       │2        │
│azure:mem2_ssd1_x4 │14.0     │128       │4        │
│azure:mem2_ssd1_x8 │28.0     │256       │8        │
│azure:mem2_ssd1_x16│56.0     │512       │16       │
│azure:mem3_ssd1_x2 │14.0     │128       │2        │
│azure:mem3_ssd1_x4 │28.0     │128       │4        │
│azure:mem3_ssd1_x8 │56.0     │256       │8        │
│azure:mem3_ssd1_x16│112.0    │512       │16       │
│azure:mem3_ssd1_x20│140.0    │640       │20       │
│azure:mem4_ssd1_x2 │28.0     │128       │2        │
│azure:mem4_ssd1_x4 │56.0     │128       │4        │
│azure:mem4_ssd1_x8 │112.0    │256       │8        │
│azure:mem4_ssd1_x16│224      │512       │16       │
│azure:mem4_ssd1_x32│448      │2048      │32       │
└───────────────────┴─────────┴──────────┴─────────┘
Default instance type: The instance type you select here will apply to all entry points
in your app unless you override it. See
https://documentation.dnanexus.com/developer/api/running-analyses/instance-types for more
information.
Choose an instance type for your app [mem1_ssd1_x4]: (Enter the default instance type you
wish to use)

*** Generating DNAnexus App Template... ***

[...]

Created files:
        mytrimmer/Readme.developer.md
        mytrimmer/Readme.md
        mytrimmer/dxapp.json
        mytrimmer/resources/
        mytrimmer/src/
        mytrimmer/src/mytrimmer.sh
        mytrimmer/test/

App directory created!

Running the DNAnexus build utility will create an executable on the DNAnexus Platform.
Any files found in the resources directory will be uploaded so that they will be present
in the root directory when the executable is run.
```

## Step 3. Add the Executable

The DNAnexus Platform runs applets on a Linux VM with a stock Ubuntu 24.04 environment. When run, your applet in turn runs an executable - the `fastq_quality_trimmer` file you downloaded in Step 1. This executable is not available on the VM by default. To make it available, enter the following commands, which create a local directory structure that becomes available on the VM when the applet runs, then copy the `fastq_quality_trimmer` file into that directory from your local machine:

`$ mkdir -p mytrimmer/resources/usr/bin/`

`$ cp /path/to/fastq_quality_trimmer mytrimmer/resources/usr/bin/`

In the second command, you need to provide the path to the `fastq_quality_trimmer` file on your local machine, substituting this for `/path/to/`.

Once the `fastq_quality_trimmer` file is in the directory `mytrimmer/resources/usr/bin/`, it can be accessed by `dx build`, which you use to build your applet, as detailed in Step 5 below. `dx build` then packages the executable, along with any other files stored in the `mytrimmer/resources` directory, as part of your applet.

## Step 4. Write the Code

In the main `mytrimmer` directory, open the `dxapp.json` file in a text editor. In the `dxapp.json` file, the `runSpec` block contains specs for both the interpreter to be used, and the name of the program to be run:

`"interpreter": "bash",`\
`"file": "src/mytrimmer.sh"`

Close the file. Navigate to the `src` directory and open the `mytrimmer.sh` file in a text editor. In the `main()` block, some code has been filled in for you.

Edit the code in the `main()` block to include the line that runs your executable. See the code line beginning with `fastq_quality_trimmer -t 20` in the code block below. Certain boilerplate comments have been omitted for brevity's sake.

```shell
#!/bin/bash

main() {

    # When the applet is run, the variable "input_file" is already set
    # to the DNAnexus link to the file object. Here, we download it to the
    # job's scratch space

    dx download "$input_file" -o input_file

    # Insert the following line between the download and upload lines

    fastq_quality_trimmer -t 20 -Q 33 -i input_file -o output_file

    # Here, we set the variable "output_file" to be the ID of the
    # uploaded file.

    output_file=$(dx upload output_file --brief)

    # This line reports the uploaded file ID under the output field
    # called "output_file".

    dx-jobutil-add-output output_file "$output_file" --class=file
}
```

## Step 5. Build the Applet

Next you build the applet using `dx build`.

Select the project in which you want to use the applet:

1. Enter the command `dx select`
2. Enter the number corresponding to the project in which you want to use the applet

Make sure you're in the directory inside of which you created the `mytrimmer` directory. From that directory, enter the command:

`$ dx build mytrimmer`

You can run `dx build` from within the `mytrimmer` directory if you prefer. If you do so, omit the directory name from the command:

`$ dx build`

Once `dx build` completes, it shows a confirmation message displaying the [unique id assigned by the Platform](https://documentation.dnanexus.com/user/platform-ids) to your new applet.

`{"id": "applet-G7GFz9805XQPKQj14ZqX9Vq3"}`

Your applet appears as a data object in your project. To see it, enter the command:

`$ dx ls`

To get more info on your applet, enter the command:

`$ dx describe mytrimmer`

You can see a description that looks like the following, with the `fastq_quality_trimmer` executable shown using its Platform ID, in the `bundledDepends` section:

```shell
$ dx describe mytrimmer
Result 1:
...
Name            mytrimmer
...
Input Spec      input_file (file)
Output Spec     output_file (file)
Interpreter     bash
bundledDepends  resources.tar.gz (file-B42KQ3pqqBkGJz8B3J900049)
...
```

## Step 6. Upload the Sample Input File

Before you run your applet using the sample input file you downloaded in Step 1, you must upload that file to the Platform.

Navigate to the local directory to which you downloaded the `small-celegans-sample.fastq` file. Upload it to the Platform using the command:

`$ dx upload small-celegans-sample.fastq`

The file appears in your project, as you see by entering the command:

`$ dx ls`

## Step 7. Run the Applet

You are ready to launch the analysis in the cloud, using 4) the `dx run` command. When you launch the analysis, the Platform brings up 5) a new Linux VM to run your code.

![Figure 3](https://1612471957-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2F-L_EsL_ie8XyZlLe_yf9%2Fuploads%2Fgit-blob-7790139ba7c7e5cd29b731dfac27dc5d8bc51861%2Frun-applet.png?alt=media)

### Launch the Applet

Launch the applet by entering the command:

`$ dx run mytrimmer -iinput_file=small-celegans-sample.fastq`

When prompted to confirm that you want to run the job with the input you designated, enter "Y."

The `dx-toolkit` then displays a confirmation that includes a Job ID, and a prompt asking if you want to watch, or monitor, your job's progress:

`Calling applet-G7GFz9805XQPKQj14ZqX9Vq3 with output destination project-G7FbxV805XQ0k10vKbG474p9:/`

`Job ID: job-G7GG1f005XQ350gFB9VY0Kb`

`Watch launched job now? [Y/n]`

### Monitor the Job

Enter "Y" if you'd like to monitor your job. This shows you a log file giving detail on every step of the job's progress.

### Access the Job's Output

When the job has finished, enter the command `dx ls` to view the files in your project. This list includes the output file generated by your applet.

Enter the command `dx get` to retrieve the output file:

`$ dx get output_file`

To see the first ten lines of the output file, enter the command:

`$ head output_file`

The excerpt of the file shows you that your applet worked correctly. The excerpt should look similar to the following:

`@SRR070372.1 FV5358E02GLGSF length=78 TTTTTTTTTTTTTTTTTTTTTTTTTTTNTTTNTTTNTTTNTTTATTTATTTATTTATTATTATATATATATATATA +SRR070372.1 FV5358E02GLGSF length=78 ...000//////999999<<<=<<666!602!777!922!688:669A9=<=122569AAA?>@BBBBAA?=<966 @SRR070372.2 FV5358E02FQJUJ length=177 TTTCTTGTAATTTGTTGGAATACGAGAACATCGTCAATAATATATCGTATGAATTGAACCACACGGCACATATTTGAACTTGTTCGTGAAATTTAGCGAACCTGGCAGGACTCGAACCTCCAATCTTCGGATCCGAAGTCCGACGCCCCCGCGTCGGATGCGTTGTTACCACTGCTT +SRR070372.2 FV5358E02FQJUJ length=177 222@99912088>C<?7779@<GIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIC;6666IIIIIIIIIIII;;;HHIIE>944=>=;22499;CIIIIIIIIIIIIHHHIIIIIIIIIIIIIIIH?;;;?IIEEEEEEEEIIII77777I7EEIIEEHHHHHIIIIIIIIIIIIII @SRR070372.3 FV5358E02GYL4S length=70 TTGGTATCATTGATATTCATTCTGGAGAACGATGGAACATACAAGAATTGTGTTAAGACCTGCATAA`

You can also run a program like [`seqmagick`](https://fhcrc.github.io/seqmagick/) to verify that the sequences have been trimmed.

### Behind the Scenes

Figure 4 gives an overview of how your applet is run. Once the Platform has instantiated a Linux VM, it runs your applet, executing the shell script commands you provided. The script runs just as it would on your local computer, 6) downloading the reads to the hard drive of the virtual machine, 7) running FASTX-Toolkit, then 8) uploading the resulting file to 9) your project.

![Figure 4](https://1612471957-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2F-L_EsL_ie8XyZlLe_yf9%2Fuploads%2Fgit-blob-1e065aa8594ccb592202fb334cd7c7ce783bd67d%2Fapplet-run-environment.png?alt=media)

## Advanced Options

### Convert Your Applet to an App

As noted above, you can [convert your applet to an app](https://documentation.dnanexus.com/developer/transitioning-from-applets-to-apps#making-the-transition) to enable others to use it in their own projects.

### Advanced Applet Options

If you wish to change the inputs or outputs of your applet, or request additional execution resources - adding network access or more CPU or memory, for example, - edit the file `mytrimmer/dxapp.json` and re-run `dx build`. See the [Advanced Applet Tutorial](https://documentation.dnanexus.com/developer/apps/advanced-app-tutorial) for a detailed overview of the `dxapp.json` file, and how to edit it.

### Other App Wizard Templates

When running `dx-app-wizard`, you selected the "basic" execution template. This means that your applet runs on a single machine. You can use the wizard's `--template` option to set more advanced execution options:

* basic: Your applet or app runs on a single machine.
* parallelized: Your applet or app subdivides a large chunk of work into multiple pieces that can be processed in parallel and independently of each other, followed by a final stage that merges and processes the results as necessary.
* scatter-process-gather: Similar to parallelized but with the addition of a "scatter" entry point. This allows you to break out the execution for splitting up the input, or you can call a separate applet or app to perform the splitting.

Try the other available templates to see examples of how to parallelize your execution over multiple machines in the cloud, by using additional [entry points](https://documentation.dnanexus.com/developer/api/running-analyses/applets-and-entry-points). You can also use other programming languages, leveraging [DNAnexus client libraries](https://documentation.dnanexus.com/developer/client-libraries). While the `dx` client provides a wide range of advanced functionality, client libraries can provide a richer experience for programmatically accessing and modifying data on the Platform, in the programming language of your choice.

### Learn More

To get a better understanding of the app directory structure and how to manually modify app inputs, outputs, and metadata, see the [Advanced Applet Tutorial](https://documentation.dnanexus.com/developer/apps/advanced-app-tutorial).

For detail on the progression of a job's states and discusses the reasons a job may fail, see [Job Lifecycle](https://documentation.dnanexus.com/user/running-apps-and-workflows/job-lifecycle).
