Introduction to Building Apps

Learn to build a custom applet and run it on the DNAnexus Platform. Optionally, convert your applet to an app so it can be run by other users, in their own projects.

Applets and Apps

Applets and apps are types of executables that can be run on the DNAnexus Platform. They differ in key ways, notably in the context in which each can be used:

  • Applets are data objects, which live inside Platform projects.

  • Apps do not live inside projects, and can be published to allow other users to run them in projects of their choosing.

Applets and apps are created in the same way, up until the final build step. At this step, the developer specifies whether the executable should be an applet or an app. You can also convert applets to apps.

For more on the difference between applets and apps, see differences between applets and apps.

Overview

In this tutorial, you learn to create an applet based on an existing executable: FastQTrimmer, one of the FASTX-Toolkit collectionarrow-up-right of command-line tools for processing short-reads FASTA and FASTQ files. You then use the applet to run FastQTrimmer on a FASTQ file, creating a trimmed reads file that you can then use for further analysis.

Figure 1 shows how you could run FastQTrimmer on your local machine, to process a sequence file in a project on the Platform. You would need to 1) use dx download to download the source file to your local machine, then 2) process it using the fastq_quality_trimmer executable called FastQTrimmer, 3) use dx upload to upload the new trimmed reads file to 4) a project on the Platform.

Figure 1

By turning FastQTrimmer into an applet, you make this process much simpler and quicker. You don't have to download or upload anything, and you can take advantage of the power of the Platform, in running FastQTrimmer.

As shown in Figure 2, you can use two DNAnexus utilities when creating your applet: dx-app-wizard (1) creates a skeleton directory for the applet, while dx build (2) adds the applet to the Platform as a data object (3) in your project.

Figure 2

Before You Begin

Before beginning this tutorial, download and install dx-toolkit. If you haven't already done so, you may also want to run through the Command Line Quickstart. You should also make sure that you're logged into the DNAnexus Platform, ideally using an API token, to prevent your being logged off before you've finished building your applet.

Step 1. Initial Downloads

Begin by downloading both:

Step 2. Run the App Wizard

Next, you need to create a local directory and a source code template for your applet. While you can do this manually, the App Wizard enables you to do so via a guided workflow in a few steps. Following is a walkthrough of this workflow, along with detail on how to respond to prompts from the Wizard:

  1. Launch the App Wizard from the CLI by entering: dx-app-wizard

  2. When prompted for the app name, enter: mytrimmer

  3. (Optional) Enter a title for your applet, or press Enter to skip.

  4. (Optional) Enter a summary for your applet, or press Enter to skip.

  5. Enter a version number, or press Enter to accept the default (0.0.1).

  6. For the first input parameter, enter: input_file

  7. (Optional) Enter a label for the input parameter, or press Enter to skip.

  8. Select file as the input parameter class type.

  9. When asked if the parameter is optional, enter: n

  10. Press Enter to finish entering input parameters.

  11. For the output parameter, enter: output_file

  12. (Optional) Enter a label for the output parameter, or press Enter to skip.

  13. Select file as the output parameter class type.

  14. Press Enter to finish entering output parameters.

  15. Set a timeout policy, or press Enter to accept the default (48h).

  16. When prompted for the programming language, enter: bash

  17. For all remaining prompts (template options, access permissions, instance type), press Enter to accept the defaults.

The App Wizard finishes by creating a local directory called mytrimmer.

Here's how this all looks, from the CLI:

Step 3. Add the Executable

The DNAnexus Platform runs applets on a Linux VM with a stock Ubuntu 24.04 environment. When run, your applet in turn runs an executable - the fastq_quality_trimmer file you downloaded in Step 1. This executable is not available on the VM by default. To make it available, enter the following commands, which create a local directory structure that becomes available on the VM when the applet runs, then copy the fastq_quality_trimmer file into that directory from your local machine:

$ mkdir -p mytrimmer/resources/usr/bin/

$ cp /path/to/fastq_quality_trimmer mytrimmer/resources/usr/bin/

In the second command, you need to provide the path to the fastq_quality_trimmer file on your local machine, substituting this for /path/to/.

Once the fastq_quality_trimmer file is in the directory mytrimmer/resources/usr/bin/, it can be accessed by dx build, which you use to build your applet, as detailed in Step 5 below. dx build then packages the executable, along with any other files stored in the mytrimmer/resources directory, as part of your applet.

Step 4. Write the Code

In the main mytrimmer directory, open the dxapp.json file in a text editor. In the dxapp.json file, the runSpec block contains specs for both the interpreter to be used, and the name of the program to be run:

"interpreter": "bash", "file": "src/mytrimmer.sh"

Close the file. Navigate to the src directory and open the mytrimmer.sh file in a text editor. In the main() block, some code has been filled in for you.

Edit the code in the main() block to include the line that runs your executable. See the code line beginning with fastq_quality_trimmer -t 20 in the code block below. Certain boilerplate comments have been omitted for brevity's sake.

Step 5. Build the Applet

Next you build the applet using dx build.

Select the project in which you want to use the applet:

  1. Enter the command dx select

  2. Enter the number corresponding to the project in which you want to use the applet

Make sure you're in the directory inside of which you created the mytrimmer directory. From that directory, enter the command:

$ dx build mytrimmer

You can run dx build from within the mytrimmer directory if you prefer. If you do so, omit the directory name from the command:

$ dx build

Once dx build completes, it shows a confirmation message displaying the unique id assigned by the Platform to your new applet.

{"id": "applet-G7GFz9805XQPKQj14ZqX9Vq3"}

Your applet appears as a data object in your project. To see it, enter the command:

$ dx ls

To get more info on your applet, enter the command:

$ dx describe mytrimmer

You can see a description that looks like the following, with the fastq_quality_trimmer executable shown using its Platform ID, in the bundledDepends section:

Step 6. Upload the Sample Input File

Before you run your applet using the sample input file you downloaded in Step 1, you must upload that file to the Platform.

Navigate to the local directory to which you downloaded the small-celegans-sample.fastq file. Upload it to the Platform using the command:

$ dx upload small-celegans-sample.fastq

The file appears in your project, as you see by entering the command:

$ dx ls

Step 7. Run the Applet

You are ready to launch the analysis in the cloud, using 4) the dx run command. When you launch the analysis, the Platform brings up 5) a new Linux VM to run your code.

Figure 3

Launch the Applet

Launch the applet by entering the command:

$ dx run mytrimmer -iinput_file=small-celegans-sample.fastq

When prompted to confirm that you want to run the job with the input you designated, enter "Y."

The dx-toolkit then displays a confirmation that includes a Job ID, and a prompt asking if you want to watch, or monitor, your job's progress:

Calling applet-G7GFz9805XQPKQj14ZqX9Vq3 with output destination project-G7FbxV805XQ0k10vKbG474p9:/

Job ID: job-G7GG1f005XQ350gFB9VY0Kb

Watch launched job now? [Y/n]

Monitor the Job

Enter "Y" if you'd like to monitor your job. This shows you a log file giving detail on every step of the job's progress.

Access the Job's Output

When the job has finished, enter the command dx ls to view the files in your project. This list includes the output file generated by your applet.

Enter the command dx get to retrieve the output file:

$ dx get output_file

To see the first ten lines of the output file, enter the command:

$ head output_file

The excerpt of the file shows you that your applet worked correctly. The excerpt should look similar to the following:

@SRR070372.1 FV5358E02GLGSF length=78 TTTTTTTTTTTTTTTTTTTTTTTTTTTNTTTNTTTNTTTNTTTATTTATTTATTTATTATTATATATATATATATA +SRR070372.1 FV5358E02GLGSF length=78 ...000//////999999<<<=<<666!602!777!922!688:669A9=<=122569AAA?>@BBBBAA?=<966 @SRR070372.2 FV5358E02FQJUJ length=177 TTTCTTGTAATTTGTTGGAATACGAGAACATCGTCAATAATATATCGTATGAATTGAACCACACGGCACATATTTGAACTTGTTCGTGAAATTTAGCGAACCTGGCAGGACTCGAACCTCCAATCTTCGGATCCGAAGTCCGACGCCCCCGCGTCGGATGCGTTGTTACCACTGCTT +SRR070372.2 FV5358E02FQJUJ length=177 222@99912088>C<?7779@<GIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIC;6666IIIIIIIIIIII;;;HHIIE>944=>=;22499;CIIIIIIIIIIIIHHHIIIIIIIIIIIIIIIH?;;;?IIEEEEEEEEIIII77777I7EEIIEEHHHHHIIIIIIIIIIIIII @SRR070372.3 FV5358E02GYL4S length=70 TTGGTATCATTGATATTCATTCTGGAGAACGATGGAACATACAAGAATTGTGTTAAGACCTGCATAA

You can also run a program like seqmagickarrow-up-right to verify that the sequences have been trimmed.

Behind the Scenes

Figure 4 gives an overview of how your applet is run. Once the Platform has instantiated a Linux VM, it runs your applet, executing the shell script commands you provided. The script runs just as it would on your local computer, 6) downloading the reads to the hard drive of the virtual machine, 7) running FASTX-Toolkit, then 8) uploading the resulting file to 9) your project.

Figure 4

Advanced Options

Convert Your Applet to an App

As noted above, you can convert your applet to an app to enable others to use it in their own projects.

Advanced Applet Options

If you wish to change the inputs or outputs of your applet, or request additional execution resources - adding network access or more CPU or memory, for example, - edit the file mytrimmer/dxapp.json and re-run dx build. See the Advanced Applet Tutorial for a detailed overview of the dxapp.json file, and how to edit it.

Other App Wizard Templates

When running dx-app-wizard, you selected the "basic" execution template. This means that your applet runs on a single machine. You can use the wizard's --template option to set more advanced execution options:

  • basic: Your applet or app runs on a single machine.

  • parallelized: Your applet or app subdivides a large chunk of work into multiple pieces that can be processed in parallel and independently of each other, followed by a final stage that merges and processes the results as necessary.

  • scatter-process-gather: Similar to parallelized but with the addition of a "scatter" entry point. This allows you to break out the execution for splitting up the input, or you can call a separate applet or app to perform the splitting.

Try the other available templates to see examples of how to parallelize your execution over multiple machines in the cloud, by using additional entry points. You can also use other programming languages, leveraging DNAnexus client libraries. While the dx client provides a wide range of advanced functionality, client libraries can provide a richer experience for programmatically accessing and modifying data on the Platform, in the programming language of your choice.

Learn More

To get a better understanding of the app directory structure and how to manually modify app inputs, outputs, and metadata, see the Advanced Applet Tutorial.

For detail on the progression of a job's states and discusses the reasons a job may fail, see Job Lifecycle.

Last updated

Was this helpful?